- Clone
- ME20.4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- p75NTR, TNFRSF16, p75(NTR), Gp80-LNGFR, NGFR, Nerve Growth Factor Receptor
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AACCGCGCTTCAGAT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
345133 | 10 µg | 296€ |
CD271, also known as p75NTR, TNFRSF16, p75(NTR), Gp80-LNGFR, and NGFR, is a type I transmembrane protein with a MW of 75 kD. It is expressed by many cell types including neurons, Schwann cells, mesenchymal stem/stromal cells, follicular dendritic cells and melanocytes. The extracellular portion contains four TNFR-Cys repeats that form the binding domain for its ligands (NGF, BDNF, NTF3, and NTF4). The intracellular portion of CD271 contains a death domain, which interacts with TRAF2, TRAF4, TRAF6, PTPN13 and RANBP9, to promote cell apoptosis, and to regulate cell differentiation and neurogenesis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- WM245 melanoma cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications for the relevant formats include: immunoprecipitation1, Western blotting4, immunohistochemical staining of frozen or paraffin embedded tissue sections1,2, and blocking of NGF binding1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Ross A, et al. 1984. P. Natl. Acad. Sci. USA 81:6681. (FC, IP, Block, IHC)
- Cattoretti G, et al. 1993. Blood 81:1726. (IHC)
- Kamke MR, et al. 2005. Hear Res. 206:89.
- Baker D, et al. 1989. Cancer Res. 49:4142-4146. (FC, WB)
- RRID
-
AB_2941526 (BioLegend Cat. No. 345133)
Antigen Details
- Structure
- Type I transmembranal protein with a MW of 75 kD. The extracellular portion contains four TNFR-Cys repeats that form the NGF binding domain; the intracellular portion contains a death domain.
- Distribution
-
Expressed by many cell types including neurons, Schwann cells, mesenchymal stem/stromal cells, follicular dendritic cells, melanocytes.
- Function
- Apoptosis, differentiation, neurogenesis.
- Interaction
- TRAF2, TRAF4, TRAF6, PTPN13, RANBP9.
- Ligand/Receptor
- Nerve growth factor (NGF), Brain-derived neurotrophic factor (BDNF), Neurotrophin 3. (NTF3) , Neurotrophin 4 (NTF4)
- Bioactivity
- Apoptosis, differentiation, neurogenesis.
- Cell Type
- Dendritic cells, Mesenchymal cells, Mesenchymal Stem Cells, Neurons
- Biology Area
- Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Neuroscience, Stem Cells, Synaptic Biology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, Postsynaptic proteins
- Antigen References
-
1. Friedman MJ, et al. 2009. J. Biol. Chem. 284:27944.
2. Rock JR, et al. 2009. Proc Natl Acad Sci USA. 106:12771.
3. Kidd SK, et al. 2008. Brain Res.1195:113.
4. Peters EM, et al. 2007. Am J Pathol. 171:1872.
5. Jansen P, et al. 2007. Nat Neurosci. 10:1449. - Gene ID
- 4804 View all products for this Gene ID
- UniProt
- View information about CD271 on UniProt.org
Other Formats
View All CD271 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD271 (NGFR) | ME20.4 | FC,IP,WB,IHC-P,IHC-F |
FITC anti-human CD271 (NGFR) | ME20.4 | FC |
PE anti-human CD271 (NGFR) | ME20.4 | FC |
APC anti-human CD271 (NGFR) | ME20.4 | FC |
PE/Cyanine7 anti-human CD271 (NGFR) | ME20.4 | FC |
PerCP/Cyanine5.5 anti-human CD271 (NGFR) | ME20.4 | FC |
Alexa Fluor® 647 anti-human CD271 (NGFR) | ME20.4 | FC |
Alexa Fluor® 700 anti-human CD271 (NGFR) | ME20.4 | FC |
PE/Dazzle™ 594 anti-human CD271 (NGFR) | ME20.4 | FC |
APC/Fire™ 750 anti-human CD271 (NGFR) | ME20.4 | FC |
Biotin anti-human CD271 (NGFR) | ME20.4 | FC |
TotalSeq™-A0816 anti-human CD271 (NGFR) | ME20.4 | PG |
APC/Cyanine7 anti-human CD271 (NGFR) | ME20.4 | FC |
TotalSeq™-C0816 anti-human CD271 (NGFR) | ME20.4 | PG |
TotalSeq™-B0816 anti-human CD271 (NGFR) | ME20.4 | PG |
Pacific Blue™ anti-human CD271 (NGFR) Antibody | ME20.4 | FC |
TotalSeq™-D0816 anti-human CD271 (NGFR) | ME20.4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD271 (NGFR)
-
FITC anti-human CD271 (NGFR)
-
PE anti-human CD271 (NGFR)
-
APC anti-human CD271 (NGFR)
-
PE/Cyanine7 anti-human CD271 (NGFR)
-
PerCP/Cyanine5.5 anti-human CD271 (NGFR)
-
Alexa Fluor® 647 anti-human CD271 (NGFR)
-
Alexa Fluor® 700 anti-human CD271 (NGFR)
-
PE/Dazzle™ 594 anti-human CD271 (NGFR)
-
APC/Fire™ 750 anti-human CD271 (NGFR)
-
Biotin anti-human CD271 (NGFR)
-
TotalSeq™-A0816 anti-human CD271 (NGFR)
-
APC/Cyanine7 anti-human CD271 (NGFR)
-
TotalSeq™-C0816 anti-human CD271 (NGFR)
-
TotalSeq™-B0816 anti-human CD271 (NGFR)
-
Pacific Blue™ anti-human CD271 (NGFR) Antibody
-
TotalSeq™-D0816 anti-human CD271 (NGFR)
Follow Us