TotalSeq™-D0156 anti-human CD95 (Fas) Antibody

Pricing & Availability
DX2 (See other available formats)
Regulatory Status
VI C-64
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Save
305659 10 µg ¥75,180

CD95 is a 45 kD single chain type I glycoprotein also known as Fas, APO-1, and TNFRSF6. It is a member of the TNF receptor superfamily. CD95 is expressed on T and B lymphocytes, monocytes, neutrophils, and fibroblasts. CD95 expression is upregulated by activation. The extracellular region of CD95 binds to CD178 (Fas ligand). CD178 binding to CD95 induces apoptosis and has been shown to play a role in the maintenance of peripheral tolerance.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Cotton-topped Tamarin, Pigtailed Macaque, Sooty Mangabey
Antibody Type
Host Species
CD95 transfected L cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The DX2 antibody is useful for inducing apoptosis of Fas-positive cells. Additional reported applications (for the relevant formats) include: in vitro induction of apoptosis3 (DX2 antibody is required to be cross-linked for effective induction of apoptosis) and immunohistochemical staining4,5 of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 305655 and 305656).

Note: EOS9.1 antibody can induce apoptosis without cross-linking.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds.1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. New York.
  3. Cifone M, et al. 1994. J. Exp. Med. 180:1547. (Apop)
  4. Zietz C, et al. 2001. Am. J. Pathol. 159:963. (IHC)
  5. Sergi C, et al. 2000. Am. J. Pathol. 156:1589. (IHC)
  6. Xie S, et al. 2010. J. Immunol. 184:2289. (FC) PubMed
  7. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  8. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
  9. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  10. Dixit N, et al. 2012. J. Immunol. 189:5954. PubMed
AB_2892366 (BioLegend Cat. No. 305659)

Antigen Details

TNFR superfamily, type I transmembrane protein, 45 kD

T cells and B cells, monocytes, neutrophils, fibroblasts, expression level upregulated on activated lymphocytes

Mediates apoptosis
Fas ligand (CD178)
Cell Type
B cells, Fibroblasts, Lymphocytes, Monocytes, Neutrophils, T cells
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology, Neuroscience
Molecular Family
CD Molecules
Antigen References

1. Krammer P, et al. 1994. Immunol. Rev. 142:175.
2. Nagata S, et al. 1995. Science 267:1449.

Gene ID
355 View all products for this Gene ID
View information about CD95 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD95 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD95 (Fas) DX2 FC
Biotin anti-human CD95 (Fas) DX2 FC
FITC anti-human CD95 (Fas) DX2 FC
PE anti-human CD95 (Fas) DX2 FC
PE/Cyanine5 anti-human CD95 (Fas) DX2 FC
Purified anti-human CD95 (Fas) DX2 FC, ICC, IHC
Alexa Fluor® 488 anti-human CD95 (Fas) DX2 FC
Alexa Fluor® 647 anti-human CD95 (Fas) DX2 FC
Brilliant Violet 421™ anti-human CD95 (Fas) DX2 FC
Pacific Blue™ anti-human CD95 (Fas) DX2 FC
PE/Cyanine7 anti-human CD95 (Fas) DX2 FC
Brilliant Violet 605™ anti-human CD95 (Fas) DX2 FC
PerCP/Cyanine5.5 anti-human CD95 (Fas) DX2 FC
Purified anti-human CD95 (Fas) (Maxpar® Ready) DX2 FC, CyTOF®
PE/Dazzle™ 594 anti-human CD95 (Fas) DX2 FC
APC/Fire™ 750 anti-human CD95 (Fas) DX2 FC
APC/Cyanine7 anti-human CD95 (Fas) DX2 FC
Brilliant Violet 510™ anti-human CD95 (Fas) DX2 FC
Brilliant Violet 711™ anti-human CD95 (Fas) DX2 FC
Brilliant Violet 785™ anti-human CD95 (Fas) DX2 FC
Brilliant Violet 650™ anti-human CD95 (Fas) DX2 FC
Alexa Fluor® 700 anti-human CD95 (Fas) DX2 FC
TotalSeq™-A0156 anti-human CD95 (Fas) DX2 PG
TotalSeq™-C0156 anti-human CD95 (Fas) DX2 PG
TotalSeq™-B0156 anti-human CD95 (Fas) DX2 PG
Ultra-LEAF™ Purified anti-human CD95 (Fas) DX2 FC, ICC, IHC, Apop
TotalSeq™-D0156 anti-human CD95 (Fas) DX2 PG
PE/Fire™ 640 anti-human CD95 (Fas) DX2 FC
KIRAVIA Blue 520™ anti-human CD95 (Fas) DX2 FC
APC/Fire™ 810 anti-human CD95 (Fas) Antibody DX2 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD95 (Fas)

  • Biotin anti-human CD95 (Fas)

  • FITC anti-human CD95 (Fas)

  • PE anti-human CD95 (Fas)

  • PE/Cyanine5 anti-human CD95 (Fas)

  • Purified anti-human CD95 (Fas)

  • Alexa Fluor® 488 anti-human CD95 (Fas)

  • Alexa Fluor® 647 anti-human CD95 (Fas)

  • Brilliant Violet 421™ anti-human CD95 (Fas)

  • Pacific Blue™ anti-human CD95 (Fas)

  • PE/Cyanine7 anti-human CD95 (Fas)

  • Brilliant Violet 605™ anti-human CD95 (Fas)

  • PerCP/Cyanine5.5 anti-human CD95 (Fas)

  • Purified anti-human CD95 (Fas) (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD95 (Fas)

  • APC/Fire™ 750 anti-human CD95 (Fas)

  • APC/Cyanine7 anti-human CD95 (Fas)

  • Brilliant Violet 510™ anti-human CD95 (Fas)

  • Brilliant Violet 711™ anti-human CD95 (Fas)

  • Brilliant Violet 785™ anti-human CD95 (Fas)

  • Brilliant Violet 650™ anti-human CD95 (Fas)

  • Alexa Fluor® 700 anti-human CD95 (Fas)

  • TotalSeq™-A0156 anti-human CD95 (Fas)

  • TotalSeq™-C0156 anti-human CD95 (Fas)

  • TotalSeq™-B0156 anti-human CD95 (Fas)

  • Ultra-LEAF™ Purified anti-human CD95 (Fas)

  • TotalSeq™-D0156 anti-human CD95 (Fas)

  • PE/Fire™ 640 anti-human CD95 (Fas)

  • KIRAVIA Blue 520™ anti-human CD95 (Fas)

  • APC/Fire™ 810 anti-human CD95 (Fas) Antibody


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account