TotalSeq™-D0352 anti-human FcεRIα Antibody

Pricing & Availability
Clone
AER-37 (CRA-1) (See other available formats)
Regulatory Status
RUO
Other Names
FceRIa, FceRI-a, FceRI-alpha, FceRI alpha, high affinity IgE receptor
Isotype
Mouse IgG2b, κ
Barcode Sequence
CTCGTTTCCGTATCG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
334651 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

High affinity IgE receptor (FcεRI) plays a key role in IgE-mediated allergic immune response. FcεRI is a tetrameric receptor complex, which is composed of one α-subunit (FcεRIα), one β-subunit, and two γ-subunits. FcεRIα directly binds IgE with high affinity, while the β- and γ-chains are responsible for mediating intracellular signals. FcεRIα is a 50 kD transmembrane protein with Ig superfamily structure. It is primarily found on mast cells and basophils. Further studies have indicated that FcεRIα is also expressed on many inflammatory cells including cutaneuos Langerhans cells, dendritic cells, monocytes of patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils produced in hypereosinophilic syndrome, and neutrophils from allergy-induced asthma patients.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone AER-37 (CRA-1) has been reported to bind the receptor even in the presence of IgE.4

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Yamaguchi M, et al. 1999. J. Immunol. 162:5455.
  2. Suzukawa M, et al. 2005. Int. Immunol. 17:1249.
  3. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  4. Yamaguchi M, et al. 1999. J. Immunol. 162:5455.
RRID
AB_2892406 (BioLegend Cat. No. 334651)

Antigen Details

Structure
Ig superfamily, 50 kD
Distribution

Mast cells, basophils, cutaneuos Langerhans cells, dendritic cells, and monocytes from the patients with allergic disorders, platelets, bronchial epithelial cells, eosinophils from hypereosinophilic syndrome, neutrophils from allergic asthmatic patients

Function
Bind IgE, trigger IgE-mediated allergic response
Ligand/Receptor
IgE
Cell Type
Basophils, Dendritic cells, Eosinophils, Langerhans cells, Mast cells, Monocytes, Neutrophils
Biology Area
Immunology
Molecular Family
Fc Receptors
Antigen References

1. Riske F, et al. 1991. J. Biol. Chem. 266:11245
2. Gounni AS, et al. 2001. FASEB J. 15:940.
3. Maurer D, et al. 1996. J. Immunol. 157:607
4. Maurer d, et al. 1994. J. Exp. Med. 179:745
5. Campbell AM, et al. 1998. Am. J. Respir. Cell Mol. Biol. 19:92.

Gene ID
2205 View all products for this Gene ID
UniProt
View information about FcepsilonRIalpha on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.24.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account