TotalSeq™-D0138 anti-human CD5 Antibody

Pricing & Availability
UCHT2 (See other available formats)
Regulatory Status
III 518
Other Names
Leu-1, Ly-1, T1, Tp67
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
300647 10 µg £245
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD5 is a 67 kD single chain type I glycoprotein also known as Leu-1, Ly-1 and T1. It is a member of the scavenger receptor superfamily found on T cells, thymocytes, B cell subsets, chronic B lymphocytic leukemia (B-CLL), and peripheral blood dendritic cells. CD5 modulates T and B cell receptor signaling, thymocyte maturation, and T-B cell interactions upon binding to ligands such as CD72.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Chimpanzee, Capuchin Monkey, Common Marmoset, Cynomolgus, Rhesus
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting2 and immunohistochemical staining of acetone-fixed frozen sections2,5.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV Oxford University Press. New York.
  2. Renaudineau Y, et al. 2005. Blood 106:2781. (WB IHC)
  3. Porter JC and Hogg N. 1997. J. Cell Biol. 138:1437.
  4. Saliba AE, et al. 2010. P. Natl. Acad. Sci. USA 107:14524. PubMed
  5. Kap Y, et al. 2009. J. Histochem. Cytochem. 57:1159. (IHC)
AB_2892344 (BioLegend Cat. No. 300647)

Antigen Details

Scavenger receptor superfamily, 67 kD

T cells, thymocytes, B cell subset, B cell CLL, peripheral blood dendritic cells

Modulates TCR, BCR signaling, thymocyte maturation, T-B cell interaction
Cell Type
B cells, Dendritic cells, Leukemia, T cells, Thymocytes
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Kipps T. 1988. Adv. Immunol. 47:117.
2. Resnick D, et al. 1993. Trends Biochem. Sci. 19:5.
3. Wood GS, et al. 1992. Am. J. Pathol. 14:789.

Gene ID
921 View all products for this Gene ID
View information about CD5 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 2    Revision Date: 12/15/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD5

  • Biotin anti-human CD5

  • FITC anti-human CD5

  • PE anti-human CD5

  • Purified anti-human CD5

  • Alexa Fluor® 647 anti-human CD5

  • PerCP anti-human CD5

  • PerCP/Cyanine5.5 anti-human CD5

  • PE/Cyanine7 anti-human CD5

  • Pacific Blue™ anti-human CD5

  • Brilliant Violet 421™ anti-human CD5

  • Purified anti-human CD5 (Maxpar® Ready)

  • APC/Cyanine7 anti-human CD5

  • Alexa Fluor® 700 anti-human CD5

  • PE/Dazzle™ 594 anti-human CD5

  • TotalSeq™-A0138 anti-human CD5

  • TotalSeq™-C0138 anti-human CD5

  • APC/Fire™ 750 anti-human CD5

  • Brilliant Violet 711™ anti-human CD5

  • TotalSeq™-B0138 anti-human CD5 Antibody

  • TotalSeq™-D0138 anti-human CD5


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account