TotalSeq™-D0088 anti-human CD279 (PD-1) Antibody

Pricing & Availability
EH12.2H7 (See other available formats)
Regulatory Status
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
329969 10 µg £245
Check Availability

Need larger quantities of this item?
Request Bulk Quote

Programmed cell death 1 (PD-1), also known as CD279, is a 55 kD member of the immunoglobulin superfamily. CD279 contains the immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic region and plays a key role in peripheral tolerance and autoimmune disease. CD279 is expressed predominantly on activated T cells, B cells, and myeloid cells. PD-L1 (B7-H1) and PD-L2 (B7-DC) are ligands of CD279 (PD-1) and are members of the B7 gene family. Evidence suggests overlapping functions for these two PD-1 ligands and their constitutive expression on some normal tissues and upregulation on activated antigen-presenting cells. Interaction of CD279 ligands results in inhibition of T cell proliferation and cytokine secretion.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Chimpanzee, Common Marmoset, Cynomolgus, Rhesus, Squirrel Monkey
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking of ligand binding1-3, immunohistochemical staining of paraformaldehyde fixed frozen sections13, and spatial biology (IBEX)15,16. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 329911 and 329912). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 329926) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Dorfman DM, et al. 2006 Am. J. Surg. Pathol. 30:802. (FA)
  2. Radziewicz H, et al. 2007. J. Virol. 81:2545. (FA)
  3. Velu V, et al. 2007. J. Virol. 81:5819. (FA)
  4. Zahn RC, et al. 2008. J. Virol. 82:11577. PubMed
  5. Chang WS, et al. 2008. J. Immunol. 181:6707. (FC) PubMed
  6. Nakamoto N, et al. 2009. PLoS Pathog. 5:e1000313. (FA)
  7. Jones RB, et al. 2009. J. Virol. 83:8722. (FC) PubMed
  8. Vojnov L, et al. 2010. J. Virol. 84:753. (FC) PubMed
  9. Radziewicz H, et al. 2010. J. Immunol. 184:2410. (FC) PubMed
  10. Monteriro P, et al. 2011. J. Immunol. 186:4618. PubMed
  11. Conrad J, et al. 2011. J. Immunol. 186:6871. PubMed
  12. Salisch NC, et al. 2010. J. Immunol. 184:476. (Rhesus reactivity)
  13. Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC)
  14. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  15. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  16. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2894607 (BioLegend Cat. No. 329969)

Antigen Details

Immunoglobulin superfamily

Transiently expressed on CD4- CD8- thymocytes; upregulated in thymocytes and splenic T and B lymphocytes; expressed on activated myeloid cells

B7-H1 (also known as PD-L1) and B7-DC (PD-L2)
Cell Type
B cells, Lymphocytes, T cells, Thymocytes, Tregs
Biology Area
Cancer Biomarkers, Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Gene ID
5133 View all products for this Gene ID
View information about CD279 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD279 Reagents Request Custom Conjugation
Description Clone Applications
Brilliant Violet 421™ anti-human CD279 (PD-1) EH12.2H7 FC
Purified anti-human CD279 (PD-1) EH12.2H7 FC, Block, IHC-F
FITC anti-human CD279 (PD-1) EH12.2H7 FC
PE anti-human CD279 (PD-1) EH12.2H7 FC, SB
APC anti-human CD279 (PD-1) EH12.2H7 FC
Alexa Fluor® 647 anti-human CD279 (PD-1) EH12.2H7 FC
PerCP/Cyanine5.5 anti-human CD279 (PD-1) EH12.2H7 FC
APC/Cyanine7 anti-human CD279 (PD-1) EH12.2H7 FC
Pacific Blue™ anti-human CD279 (PD-1) EH12.2H7 FC
PE/Cyanine7 anti-human CD279 (PD-1) EH12.2H7 FC
Purified anti-human CD279 (PD-1) (Maxpar® Ready) EH12.2H7 FC, CyTOF®
Brilliant Violet 605™ anti-human CD279 (PD-1) EH12.2H7 FC
Ultra-LEAF™ Purified anti-human CD279 (PD-1) EH12.2H7 FC, Block, IHC-F
Brilliant Violet 711™ anti-human CD279 (PD-1) EH12.2H7 FC
Brilliant Violet 785™ anti-human CD279 (PD-1) EH12.2H7 FC
Brilliant Violet 510™ anti-human CD279 (PD-1) EH12.2H7 FC
Biotin anti-human CD279 (PD-1) EH12.2H7 FC
PE/Dazzle™ 594 anti-human CD279 (PD-1) EH12.2H7 FC
Alexa Fluor® 488 anti-human CD279 (PD-1) EH12.2H7 FC
PerCP anti-human CD279 (PD-1) EH12.2H7 FC
GoInVivo™ Purified anti-human CD279 (PD-1) EH12.2H7 FC, Block, IHC
Brilliant Violet 650™ anti-human CD279 (PD-1) EH12.2H7 FC
Alexa Fluor® 700 anti-human CD279 (PD-1) EH12.2H7 FC
APC/Fire™ 750 anti-human CD279 (PD-1) EH12.2H7 FC
TotalSeq™-A0088 anti-human CD279 (PD-1) EH12.2H7 PG
TotalSeq™-B0088 anti-human CD279 (PD-1) EH12.2H7 PG
TotalSeq™-C0088 anti-human CD279 (PD-1) EH12.2H7 PG
Brilliant Violet 750™ anti-human CD279 (PD-1) EH12.2H7 FC
TotalSeq™-D0088 anti-human CD279 (PD-1) EH12.2H7 PG
PE/Fire™ 640 anti-human CD279 (PD-1) EH12.2H7 FC
PE/Cyanine5 anti-human CD279 (PD-1) EH12.2H7 FC
Go To Top Version: 1    Revision Date: 08/12/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Brilliant Violet 421™ anti-human CD279 (PD-1)

  • Purified anti-human CD279 (PD-1)

  • FITC anti-human CD279 (PD-1)

  • PE anti-human CD279 (PD-1)

  • APC anti-human CD279 (PD-1)

  • Alexa Fluor® 647 anti-human CD279 (PD-1)

  • PerCP/Cyanine5.5 anti-human CD279 (PD-1)

  • APC/Cyanine7 anti-human CD279 (PD-1)

  • Pacific Blue™ anti-human CD279 (PD-1)

  • PE/Cyanine7 anti-human CD279 (PD-1)

  • Purified anti-human CD279 (PD-1) (Maxpar® Ready)

  • Brilliant Violet 605™ anti-human CD279 (PD-1)

  • Ultra-LEAF™ Purified anti-human CD279 (PD-1)

  • Brilliant Violet 711™ anti-human CD279 (PD-1)

  • Brilliant Violet 785™ anti-human CD279 (PD-1)

  • Brilliant Violet 510™ anti-human CD279 (PD-1)

  • Biotin anti-human CD279 (PD-1)

  • PE/Dazzle™ 594 anti-human CD279 (PD-1)

  • Alexa Fluor® 488 anti-human CD279 (PD-1)

  • PerCP anti-human CD279 (PD-1)

  • GoInVivo™ Purified anti-human CD279 (PD-1)

  • Brilliant Violet 650™ anti-human CD279 (PD-1)

  • Alexa Fluor® 700 anti-human CD279 (PD-1)

  • APC/Fire™ 750 anti-human CD279 (PD-1)

  • TotalSeq™-A0088 anti-human CD279 (PD-1)

  • TotalSeq™-B0088 anti-human CD279 (PD-1)

  • TotalSeq™-C0088 anti-human CD279 (PD-1)

  • Brilliant Violet 750™ anti-human CD279 (PD-1)

  • TotalSeq™-D0088 anti-human CD279 (PD-1)

  • PE/Fire™ 640 anti-human CD279 (PD-1)

  • PE/Cyanine5 anti-human CD279 (PD-1)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account