TotalSeq™-D0054 anti-human CD34 Antibody

Pricing & Availability
581 (See other available formats)
Regulatory Status
V MA27
Other Names
Gp105-120, My10
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
343543 10 µg £222.00
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD34, also known as gp105-120, is a type I monomeric sialomucin-like glycophosphoprotein with an approximate molecular weight of 105-120 kD. Selectively expressed on the majority of hematopoietic stem/progenitor cells, bone marrow stromal cells, capillary endothelial cells, embryonic fibroblasts, and some nervous tissue, CD34 is a commonly used marker to identify human hematopoietic stem/progenitor cells. According to the differential sensitivity to enzymatic cleavage, four groups of epitopes of CD34 have been described. CD34 mediates cell adhesion and lymphocytes homing through binding to L-selectin and E-selectin ligands.

Product Details
Technical Data Sheet (pdf)

Product Details

Human, Cross-Reactivity: Cynomolgus
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 581 antibody recognizes the class III group epitope which is resistant to sialidase/glycolyprotease and chymopapain treatment. Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections5 and immunofluorescence6.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman SF, et al. 1995. Leukocyte Typing V:White Cell Differentiation Antigen. New York:Oxford University Press.
  2. Felschow DM, et al. 2001. Blood 97:3768.
  3. Rudin CE, et al. 1997. Br. J. Haematol. 97:488.
  4. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  5. Skowasch D, et al. 2003. Cardiovasc Res. 60:684. (IHC)
  6. Umland O, et al. 2003. J. Histochem. Cytochem. 51:977. (IF)
AB_2892416 (BioLegend Cat. No. 343543)

Antigen Details

105-120 kD single chain mucin-like glycoprotein

Hematopoietic stem/progenitor cells, bone marrow stromal cells, endothelial cells, embryonic fibroblasts

Cell adhesion
L-selectin, E-selectin
Cell Type
Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors
Biology Area
Cell Biology, Immunology, Neuroinflammation, Neuroscience, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Krause DS, et al. 1996. Blood. 87:1.
2. Puri KD, et al. 1995. J Cell Biol. 131:261.
3. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. John Wiley & Sons Inc, Hoboken New Jersey.

Gene ID
947 View all products for this Gene ID
View information about CD34 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/21/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Insert Note Here
Save Close Clear
Lab Timer
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account