TotalSeq™-D0006 anti-human CD86 Antibody

Pricing & Availability
IT2.2 (See other available formats)
Regulatory Status
VI CD86.8
Other Names
B7-2, B70
Mouse IgG2b, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Save
305453 10 µg ¥75,180

CD86 is an 80 kD immunoglobulin superfamily member also known as B7-2, B70, and Ly-58. CD86 is expressed on activated B and T cells, monocytes/macrophages, dendritic cells, and astrocytes. CD86, along with CD80, is the ligand of CD28 and CD152 (CTLA-4). CD86 is expressed earlier in the immune response than CD80. CD86 has also been shown to be involved in immunoglobulin class-switching and triggering of NK cell-mediated cytotoxicity. CD86 binds to CD28 to transduce costimulatory signals for T cell activation, proliferation, and cytokine production. CD86 can bind to CD152 as well, also known as CTLA-4, to deliver an inhibitory signal to T cells.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Capuchin Monkey, Common Marmoset, Cotton-topped Tamarin, Chimpanzee
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6, Western blotting3, and blocking of T cell activation2,4,5. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 305449 & 305450).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
  2. Dieu M. 1998. J. Exp. Med. 188:373. (Block)
  3. Esser M, et al. 2001. J. Virol. 75:6173. (WB)
  4. Jeannin P, et al. 1999. J. Immunol. 162:2044. (Block)
  5. Kapsogeorgou EK, et al. 2001. J. Immunol. 166:3107. (Block)
  6. Geissmann F, et al. 2001. Blood 97:1241. (IHC)
AB_2892364 (BioLegend Cat. No. 305453)

Antigen Details

Ig superfamily, single-chain transmembrane glycoprotein, 80 kD

Monocytes/macrophages, activated B cells and T cells, dendritic cells

T cell costimulation
CD28, CD152
Cell Type
B cells, Dendritic cells, Macrophages, Monocytes, T cells, Tregs
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Hathcock K, et al. 1996. Adv. Immunol. 62:131.
2. June C, et al. 1994. Immunol. Today 15:321.

Gene ID
942 View all products for this Gene ID
View information about CD86 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Biotin anti-human CD86

  • PE anti-human CD86

  • PE/Cyanine5 anti-human CD86

  • Purified anti-human CD86

  • APC anti-human CD86

  • Alexa Fluor® 488 anti-human CD86

  • Alexa Fluor® 647 anti-human CD86

  • Pacific Blue™ anti-human CD86

  • PE/Cyanine7 anti-human CD86

  • PerCP/Cyanine5.5 anti-human CD86

  • Brilliant Violet 421™ anti-human CD86

  • Brilliant Violet 650™ anti-human CD86

  • Brilliant Violet 605™ anti-human CD86

  • Brilliant Violet 510™ anti-human CD86

  • PE/Dazzle™ 594 anti-human CD86

  • Purified anti-human CD86 (Maxpar® Ready)

  • Brilliant Violet 711™ anti-human CD86

  • Brilliant Violet 785™ anti-human CD86

  • TotalSeq™-A0006 anti-human CD86

  • TotalSeq™-B0006 anti-human CD86

  • TotalSeq™-C0006 anti-human CD86

  • Ultra-LEAF™ Purified anti-human CD86

  • KIRAVIA Blue 520™ anti-human CD86

  • TotalSeq™-D0006 anti-human CD86

  • PE/Fire™ 810 anti-human CD86

  • PE/Fire™ 640 anti-human CD86


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account