TotalSeq™-D0358 anti-human CD163 Antibody

Pricing & Availability
GHI/61 (See other available formats)
Regulatory Status
VI M38
Other Names
GHI/61, M130, RM3/1, p155, Hemoglobin/Haptoglobin Complex Receptor, macrophage-associated antigen, ED2(rat)
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
333641 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD163 is a member of the group B scavenger receptor cysteine-rich superfamily, also known as GHI/61, M130, RM3/1, p155, hemoglobin-haptoglobin complex receptor, or macrophage-associated antigen. It is a 134 kD (non-reduced)/155 kD (reduced) glycoprotein primarily expressed on macrophages, Kupffer cells, monocytes, a subset of dendritic cells, and a subset of hematopoietic stem/progenitor cells. CD163 binds to haptoglobin-hemoglobin complex and TWEAK, and plays a role in clearing hemoglobin and regulating cytokine production by macrophages. Membrane CD163 can be cleaved by metalloproteinases (MMP), resulting in a soluble form. Elevated serum level of sCD163 has been implicated in many kinds of inflammatory diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone GHI/61 binds to domain 7 of CD163. Additional reported applications (for the relevant formats) include: immunocytochemical staining, immunoprecipitation, western blot1, and spatial biology (IBEX)6,7.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Pulford K, et al. 1992. Immunology 75:588. (ICC, IP, WB)
  2. Law SK, et al. 1993. Eur. J. Immunol. 23:2320.
  3. Madsen M, et al. 2004. J. Biol. Chem. 279:51561.
  4. Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
  5. Buttari B, et al. 2011. Atherosclerosis. 215:316. PubMed
  6. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  7. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2904357 (BioLegend Cat. No. 333641)

Antigen Details

134 kD (non-reduced)/155 kD (reduced) glycoprotein, scavenger receptor superfamily

Monocytes, macrophages, Kuffer cells, subset of dendritic cells, subset of hematopoietic stem/progenitor cells

Clearance of haptoglobin-hemoglobin complex, regulation of cytokine production by macrophages
Haptoglobin-hemoglobin complex, TWEAK
Cell Type
Dendritic cells, Hematopoietic stem and progenitors, Macrophages, Monocytes
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Roth J, et al. 1994 Transolantation. 57:127
2. Van den Heuvel MM, et al.1999 J. Leukoc. Biol. 66:858
3. Sulahian TH, et al. 2000 Cytokines 12:1312
4. Fabriek BO, et al. 2007 J. Neuroimmunol. 187:179

Gene ID
9332 View all products for this Gene ID
View information about CD163 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/05/2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • PerCP anti-human CD163

  • Purified anti-human CD163

  • Biotin anti-human CD163

  • PE anti-human CD163

  • PerCP/Cyanine5.5 anti-human CD163

  • APC anti-human CD163

  • Brilliant Violet 421™ anti-human CD163

  • PE/Cyanine7 anti-human CD163

  • Brilliant Violet 605™ anti-human CD163

  • FITC anti-human CD163

  • Alexa Fluor® 647 anti-human CD163

  • APC/Cyanine7 anti-human CD163

  • PE/Dazzle™ 594 anti-human CD163

  • Brilliant Violet 510™ anti-human CD163

  • Brilliant Violet 711™ anti-human CD163

  • Brilliant Violet 785™ anti-human CD163

  • APC/Fire™ 750 anti-human CD163

  • TotalSeq™-A0358 anti-human CD163

  • TotalSeq™-C0358 anti-human CD163

  • TotalSeq™-B0358 anti-human CD163

  • PE/Cyanine5 anti-human CD163

  • TotalSeq™-D0358 anti-human CD163


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account