- Clone
- L243 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Major Histocompatibility Class II, MHC class II
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- AATAGCGAGCAAGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
307681 | 10 µg | 296€ |
HLA-DR is a heterodimeric cell surface glycoprotein comprised of a 36 kD α (heavy) chain and a 27 kD β (light) chain. It is expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In conjunction with the CD3/TCR complex and CD4 molecules, HLA-DR is critical for efficient peptide presentation to CD4+ T cells.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon, Chimpanzee, Dog, Common Marmoset, Squirrel Monkey, Cotton-topped Tamarin
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The L243 monoclonal antibody reacts with the HLA-DR antigen, a member of MHC class II molecules. It does not cross react with HLA-DP and HLA-DQ. Clone L243 binds a conformational epitope on HLA-DRa which depends on the correct folding of the aß heterodimer.19
Additional reported applications (for the relevant formats) include: immunoprecipitation8, Western blotting8, in vitro blocking of mixed lymphocyte reactions9,10, depeletion of MHC class II cells7, immunohistochemical staining of acetone-fixed frozen sections4,5, and spatial biology (IBEX)21,22. For sensitive functional assays, we recommend using the Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) (Cat. No. 307648, 307665 - 307669). - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Brodsky F. 1984. Immunogenetics 19:179.
- Robbins P, et al. 1987. Human Immunol. 18:301.
- Stites D, et al. 1986. Clin. Immunol. Immunopathol. 38:161.
- Warnke R, et al. 1980. J. Histochem. Cytochem. 28:771. (IHC)
- Engleman E, et al. 1981. P. Natl. Acad. Sci. USA 78:1791. (IHC)
- Zipf T, et al. 1981. Cancer Res. 41:4786.
- Goodier M, et al. 2000. J. Immunol. 165:139. (Depletion)
- Esser M, et al. 2001. J. Virol. 75:6173. (IP, WB)
- Kalka-Moll WM, et al. 2002. J. Immunol. 169:6149. (Block)
- Wang RF, et al. 1999. Science 284:1351. (Block)
- Zaba LC, et al. 2007. J. Exp. Med. 204:3183. PubMed
- Fujita H, et al. 2009. P. Natl. Acad. Sci. USA 106:21795. PubMed
- Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
- Goncalves RM, et al. 2010. Infect. Immun. 78:4763. PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
- Stein R, et al. 2011. Leuk. Lymphoma 52:273.
- Galkowska H, et al. 1996. Vet. Immunol. Immunopathol. 53:329.
- Moro M, et al. 2005. BMC Immunol. 6:24.
- Lauterbach N, et al. 2014. Mol Immunol. 59:19. PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892373 (BioLegend Cat. No. 307681)
Antigen Details
- Structure
- Ig superfamily, MHC class II, heterodimeric transmembrane protein, 36 kD heavy and 27 kD light chain
- Distribution
-
B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs
- Function
- Peptide presentation
- Ligand/Receptor
- CD3/TCR, CD4
- Cell Type
- Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells, Tregs
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- MHC Antigens
- Antigen References
-
1. Levacher M, et al. 1990. Clin. Exp. Immunol. 81:177.
2. Terstappen L, et al. 1990. J. Leukocyte Biol. 48:138.
3. Edwards JA, et al. 1986. J. Immunol. 137:490.
4. van Es A, et al. 1984. Transplantation 37:65.
5. O'Doherty U, et al. 1994. Immunology 82:487.
6. Thomas R, et al. 1994. J. Immunol. 153:4016.
7. Grouard G, et al. 1996. Nature 384:364. - Gene ID
- 3122 View all products for this Gene ID 3123 View all products for this Gene ID
- UniProt
- View information about HLA-DR on UniProt.org
Related FAQs
Other Formats
View All HLA-DR Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human HLA-DR
-
FITC anti-human HLA-DR
-
PE anti-human HLA-DR
-
PE/Cyanine5 anti-human HLA-DR
-
Purified anti-human HLA-DR
-
Biotin anti-human HLA-DR
-
PE/Cyanine7 anti-human HLA-DR
-
APC/Cyanine7 anti-human HLA-DR
-
Alexa Fluor® 488 anti-human HLA-DR
-
Alexa Fluor® 647 anti-human HLA-DR
-
Pacific Blue™ anti-human HLA-DR
-
Alexa Fluor® 700 anti-human HLA-DR
-
PerCP anti-human HLA-DR
-
PerCP/Cyanine5.5 anti-human HLA-DR
-
Brilliant Violet 605™ anti-human HLA-DR
-
Brilliant Violet 421™ anti-human HLA-DR
-
Brilliant Violet 570™ anti-human HLA-DR
-
Brilliant Violet 711™ anti-human HLA-DR
-
Brilliant Violet 785™ anti-human HLA-DR
-
Brilliant Violet 510™ anti-human HLA-DR
-
Ultra-LEAF™ Purified anti-human HLA-DR
-
Brilliant Violet 650™ anti-human HLA-DR
-
Purified anti-human HLA-DR (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-human HLA-DR
-
FITC anti-human HLA-DR
-
APC/Fire™ 750 anti-human HLA-DR
-
Pacific Blue™ anti-human HLA-DR
-
APC anti-human HLA-DR
-
PE/Dazzle™ 594 anti-human HLA-DR
-
PE/Cyanine7 anti-human HLA-DR
-
TotalSeq™-A0159 anti-human HLA-DR
-
TotalSeq™-B0159 anti-human HLA-DR
-
TotalSeq™-C0159 anti-human HLA-DR
-
Brilliant Violet 750™ anti-human HLA-DR
-
APC/Fire™ 750 anti-human HLA-DR
-
PerCP/Cyanine5.5 anti-human HLA-DR
-
APC/Fire™ 810 anti-human HLA-DR
-
PE/Fire™ 640 anti-human HLA-DR
-
PE anti-human HLA-DR
-
Spark Violet™ 538 anti-human HLA-DR Antibody
-
KIRAVIA Blue 520™ anti-human HLA-DR
-
TotalSeq™-D0159 anti-human HLA-DR
-
PE/Fire™ 810 anti-human HLA-DR
-
GMP PE/Dazzle™ 594 anti-human HLA-DR
-
Spark Violet™ 423 anti-human HLA-DR
-
PerCP anti-human HLA-DR
-
GMP FITC anti-human HLA-DR
-
GMP APC anti-human HLA-DR
-
GMP PE/Cyanine7 anti-human HLA-DR
-
GMP Pacific Blue™ anti-human HLA-DR
-
GMP APC/Fire™ 750 anti-human HLA-DR
-
Spark Violet™ 500 anti-human HLA-DR
-
GMP PerCP/Cyanine5.5 anti-human HLA-DR
-
GMP PE anti-human HLA-DR
-
Spark UV™ 387 anti-human HLA-DR
-
Spark Blue™ 515 anti-human HLA-DR
-
Spark NIR™ 685 anti-human HLA-DR
-
Spark Blue™ 550 anti-human HLA-DR (Flexi-Fluor™)
-
Spark Red™ 718 anti-human HLA-DR (Flexi-Fluor™)
Follow Us