TotalSeq™-D0390 anti-human CD127 (IL-7Rα) Antibody

Pricing & Availability
A019D5 (See other available formats)
Regulatory Status
Other Names
IL-7 receptor α chain, IL-7Rα
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
351371 10 µg 358 CHF
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD127 is a 60-90 kD type I transmembrane glycoprotein also known as IL-7 receptor α chain or IL-7Rα. It forms a heterodimer with the common γ chain (γc or CD132) which is shared with the receptors for IL-2, IL-4, IL-9, IL-13, IL-15, and IL-21. CD127 is expressed on immature B cells through early pre-B stage cells, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, and bone marrow stromal cells. CD127 has been reported to be a useful marker for identifying memory and effector T cells. Studies have shown that CD127 expression is down-modulated on Treg cells. It can be used as a marker for differentiation of Treg and conventional T cells. The ligation of IL-7 with its receptor is important for stimulation of mature and immature T cells as well as immature B cell proliferation and development.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Host Species
Recombinant human CD127
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for the relevant formats) application: proteogenomics1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
AB_2892428 (BioLegend Cat. No. 351371)

Antigen Details

Type I transmembrane glycoprotein, associates with CD132, 60-90 kD

Immature B cells through early pre-B stage, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, bone marrow stromal cells

T cell and immature B cell proliferation and development
Cell Type
B cells, T cells, Thymocytes, Tregs
Biology Area
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Sudo T, et al. 1993. P. Natl. Acad. Sci. USA 90:9125.
2. He YW and Malek TR. 1998. Crit. Rev. Immunol. 18:503.
3. Huster KM, et al. 2004. P. Natl. Acad. Sci. USA 101:5610.
4. Pillai M, et al. 2004. Leukemia Lymphoma 45:2403.
5. Morrissey PJ, et al. 1989. J. Exp. Med. 169:707.
6. Liu W, et al. 2006. J. Exp. Med. 203:1701.

Gene ID
3575 View all products for this Gene ID
View information about CD127 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD127 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD127 (IL-7Rα) A019D5 FC
PE anti-human CD127 (IL-7Rα) A019D5 FC
Pacific Blue™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 421™ anti-human CD127 (IL-7Rα) A019D5 FC
FITC anti-human CD127 (IL-7Rα) A019D5 FC
Alexa Fluor® 488 anti-human CD127 (IL-7Rα) A019D5 FC
APC anti-human CD127 (IL-7Rα) A019D5 FC
Alexa Fluor® 647 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Cyanine7 anti-human CD127 (IL-7Rα) A019D5 FC
PerCP/Cyanine5.5 anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 570™ anti-human CD127 (IL-7Rα) A019D5 FC
PE/Cyanine5 anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 650™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 711™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 785™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 510™ anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 605™ anti-human CD127 (IL-7Rα) A019D5 FC
PE/Dazzle™ 594 anti-human CD127 (IL-7Rα) A019D5 FC
Purified anti-human CD127 (IL-7Rα) (Maxpar® Ready) A019D5 FC, CyTOF®
Alexa Fluor® 700 anti-human CD127 (IL-7Rα) A019D5 FC
Biotin anti-human CD127 (IL-7Rα) A019D5 FC
APC/Cyanine7 anti-human CD127 (IL-7Rα) A019D5 FC
APC/Fire™ 750 anti-human CD127 (IL-7Rα) A019D5 FC
TotalSeq™-A0390 anti-human CD127 (IL-7Rα) A019D5 PG
TotalSeq™-B0390 anti-human CD127 (IL-7Rα) A019D5 PG
TotalSeq™-C0390 anti-human CD127 (IL-7Rα) A019D5 PG
KIRAVIA Blue 520™ anti-human CD127 (IL-7Rα) A019D5 FC
Spark NIR™ 685 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Fire™ 640 anti-human CD127 (IL-7Rα) A019D5 FC
PE/Fire™ 700 anti-human CD127 (IL-7Rα) Antibody A019D5 FC
Spark YG™ 581 anti-human CD127 (IL-7Rα) A019D5 FC
Brilliant Violet 750™ anti-human CD127 (IL-7Rα) A019D5 FC
TotalSeq™-D0390 anti-human CD127 (IL-7Rα) A019D5 PG
APC/Fire™ 810 anti-human CD127 (IL-7Rα) Antibody A019D5 FC
APC/Fire™ 750 anti-human CD127 A019D5 FC
PE anti-human CD127 A019D5 FC
PerCP/Cyanine5.5 anti-human CD127 A019D5 FC
PE/Cyanine7 anti-human CD127 A019D5 FC
Spark Red™ 718 anti-human CD127 (IL-7Rα) A019D5 FC
Go To Top Version: 1    Revision Date: 05.25.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD127 (IL-7Rα)

  • PE anti-human CD127 (IL-7Rα)

  • Pacific Blue™ anti-human CD127 (IL-7Rα)

  • Brilliant Violet 421™ anti-human CD127 (IL-7Rα)

  • FITC anti-human CD127 (IL-7Rα)

  • Alexa Fluor® 488 anti-human CD127 (IL-7Rα)

  • APC anti-human CD127 (IL-7Rα)

  • Alexa Fluor® 647 anti-human CD127 (IL-7Rα)

  • PE/Cyanine7 anti-human CD127 (IL-7Rα)

  • PerCP/Cyanine5.5 anti-human CD127 (IL-7Rα)

  • Brilliant Violet 570™ anti-human CD127 (IL-7Rα)

  • PE/Cyanine5 anti-human CD127 (IL-7Rα)

  • Brilliant Violet 650™ anti-human CD127 (IL-7Rα)

  • Brilliant Violet 711™ anti-human CD127 (IL-7Rα)

  • Brilliant Violet 785™ anti-human CD127 (IL-7Rα)

  • Brilliant Violet 510™ anti-human CD127 (IL-7Rα)

  • Brilliant Violet 605™ anti-human CD127 (IL-7Rα)

  • PE/Dazzle™ 594 anti-human CD127 (IL-7Rα)

  • Purified anti-human CD127 (IL-7Rα) (Maxpar® Ready)

  • Alexa Fluor® 700 anti-human CD127 (IL-7Rα)

  • Biotin anti-human CD127 (IL-7Rα)

  • APC/Cyanine7 anti-human CD127 (IL-7Rα)

  • APC/Fire™ 750 anti-human CD127 (IL-7Rα)

  • TotalSeq™-A0390 anti-human CD127 (IL-7Rα)

  • TotalSeq™-B0390 anti-human CD127 (IL-7Rα)

  • TotalSeq™-C0390 anti-human CD127 (IL-7Rα)

  • KIRAVIA Blue 520™ anti-human CD127 (IL-7Rα)

  • Spark NIR™ 685 anti-human CD127 (IL-7Rα)

  • PE/Fire™ 640 anti-human CD127 (IL-7Rα)

  • PE/Fire™ 700 anti-human CD127 (IL-7Rα) Antibody

  • Spark YG™ 581 anti-human CD127 (IL-7Rα)

  • Brilliant Violet 750™ anti-human CD127 (IL-7Rα)

  • TotalSeq™-D0390 anti-human CD127 (IL-7Rα)

  • APC/Fire™ 810 anti-human CD127 (IL-7Rα) Antibody

  • APC/Fire™ 750 anti-human CD127

  • PE anti-human CD127

  • PerCP/Cyanine5.5 anti-human CD127

  • PE/Cyanine7 anti-human CD127

  • Spark Red™ 718 anti-human CD127 (IL-7Rα)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account