TotalSeq™-D0389 anti-human CD38 Antibody

Pricing & Availability
HIT2 (See other available formats)
Regulatory Status
III 155
Other Names
T10, ADP-ribosyl cyclase
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
303553 10 µg 358 CHF
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD38 is a 45 kD type II transmembrane glycoprotein also known as T10. It is an ADP-ribosyl hydrolase expressed at variable levels on hematopoietic cells and in some non-hematopoietic tissues (such as brain, muscles, and kidney). In humans, it is expressed at high levels on plasma cells and activated T and B cells. By functioning as both a cyclase and a hydrolase, CD38 mediates lymphocyte activation, adhesion, and the metabolism of cADPR and NAADP. CD31 is the ligand of CD38.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Reported Reactivity
Chimpanzee, Horse, Cow
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6 and spatial biology (IBEX)10,11.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
  2. Dieu M. 1998. J. Exp. Med. 188:373.
  3. Esser M, et al. 2001. J. Virol. 75:6173.
  4. Jeannin P, et al. 1999. J. Immunol. 162:2044.
  5. Kapsogeorgou EK, et al. 2001. J. Immunol. 166:3107.
  6. van der Voort R, et al. 1997. J. Exp. Med. 185:2121. (IHC)
  7. Bende RJ, et al. 2003. Am. J. Pathol. 162:105.
  8. Lehner M, et al. 2008. J. Leukoc. Biol. 83:883. PubMed
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  10. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  11. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
AB_2892351 (BioLegend Cat. No. 303553)

Antigen Details

ADP-ribosyl cyclase, ectoenzyme, type II glycoprotein, 45 kD

T cells, B cells, NK, myeloid, plasma, and dendritic cells

Ecto-ADP-ribosyl cyclase, calcium signaling, cell activation
CD31, hyaluronic acid
Cell Type
B cells, Dendritic cells, NK cells, Plasma cells, T cells
Biology Area
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Ferrero E, et al. 1999. J. Leukoc. Biol. 65:151.
2. Lund F, et al. 1995. Immunol. Today 16:469.

Gene ID
952 View all products for this Gene ID
View information about CD38 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD38 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD38 HIT2 FC
FITC anti-human CD38 HIT2 FC
PE anti-human CD38 HIT2 FC
PE/Cyanine5 anti-human CD38 HIT2 FC
Purified anti-human CD38 HIT2 FC, CyTOF®, IHC-F
Alexa Fluor® 488 anti-human CD38 HIT2 FC
Alexa Fluor® 647 anti-human CD38 HIT2 FC
PE/Cyanine7 anti-human CD38 HIT2 FC
Biotin anti-human CD38 HIT2 FC
PerCP anti-human CD38 HIT2 FC
PerCP/Cyanine5.5 anti-human CD38 HIT2 FC
Alexa Fluor® 700 anti-human CD38 HIT2 FC, SB
Brilliant Violet 421™ anti-human CD38 HIT2 FC
Brilliant Violet 711™ anti-human CD38 HIT2 FC
Brilliant Violet 785™ anti-human CD38 HIT2 FC
Brilliant Violet 605™ anti-human CD38 HIT2 FC
APC/Cyanine7 anti-human CD38 HIT2 FC
Purified anti-human CD38 (Maxpar® Ready) HIT2 FC, CyTOF®
PE/Dazzle™ 594 anti-human CD38 HIT2 FC
PE anti-human CD38 HIT2 FC
Brilliant Violet 510™ anti-human CD38 HIT2 FC
FITC anti-human CD38 HIT2 FC
PE/Dazzle™ 594 anti-human CD38 HIT2 FC
TotalSeq™-A0389 anti-human CD38 HIT2 PG
TotalSeq™-C0389 anti-human CD38 HIT2 PG
APC/Fire™ 750 anti-human CD38 HIT2 FC
TotalSeq™-B0389 anti-human CD38 HIT2 PG
APC/Fire™ 810 anti-human CD38 HIT2 FC
Spark NIR™ 685 anti-human CD38 Antibody HIT2 FC
TotalSeq™-D0389 anti-human CD38 HIT2 PG
PerCP/Cyanine5.5 anti-human CD38 HIT2 FC
APC anti-human CD38 HIT2 FC
APC/Fire™ 750 anti-human CD38 HIT2 FC
PE/Cyanine7 anti-human CD38 HIT2 FC
GMP PE anti-human CD38 HIT2 FC
GMP FITC anti-human CD38 HIT2 FC
Pacific Blue™ anti-human CD38 HIT2 FC
Go To Top Version: 2    Revision Date: 12.16.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD38

  • FITC anti-human CD38

  • PE anti-human CD38

  • PE/Cyanine5 anti-human CD38

  • Purified anti-human CD38

  • Alexa Fluor® 488 anti-human CD38

  • Alexa Fluor® 647 anti-human CD38

  • PE/Cyanine7 anti-human CD38

  • Biotin anti-human CD38

  • PerCP anti-human CD38

  • PerCP/Cyanine5.5 anti-human CD38

  • Alexa Fluor® 700 anti-human CD38

  • Brilliant Violet 421™ anti-human CD38

  • Brilliant Violet 711™ anti-human CD38

  • Brilliant Violet 785™ anti-human CD38

  • Brilliant Violet 605™ anti-human CD38

  • APC/Cyanine7 anti-human CD38

  • Purified anti-human CD38 (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD38

  • PE anti-human CD38

  • Brilliant Violet 510™ anti-human CD38

  • FITC anti-human CD38

  • PE/Dazzle™ 594 anti-human CD38

  • TotalSeq™-A0389 anti-human CD38

  • TotalSeq™-C0389 anti-human CD38

  • APC/Fire™ 750 anti-human CD38

  • TotalSeq™-B0389 anti-human CD38

  • APC/Fire™ 810 anti-human CD38

  • Spark NIR™ 685 anti-human CD38 Antibody

  • TotalSeq™-D0389 anti-human CD38

  • PerCP/Cyanine5.5 anti-human CD38

  • APC anti-human CD38

  • APC/Fire™ 750 anti-human CD38

  • PE/Cyanine7 anti-human CD38

  • GMP PE anti-human CD38

  • GMP FITC anti-human CD38

  • Pacific Blue™ anti-human CD38


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account