TotalSeq™-D0169 anti-human CD366 (Tim-3) Antibody

Pricing & Availability
Clone
F38-2E2 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
T cell immunoglobulin and mucin domain containing protein 3, hepatitis virus cellular receptor 2, CD366
Isotype
Mouse IgG1, κ
Barcode Sequence
TGTCCTACCCAACTT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
345057 10 µg 358 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD366 (Tim-3) is a transmembrane protein also known as T cell immunoglobulin and mucin domain containing protein-3. Tim-3 is expressed at high levels on activated T cells (preferentially on Th1 cells, monocytes/macrophages, and dendritic cells). Tim-3 has also been shown to exist as a soluble protein. Cells expressing Tim-3 are present at high levels in the CNS of animals at the onset of experimental autoimmune encephalomyelitis (EAE), a disease mediated by lymphocytes secreting Th1-like cytokines. Tim-3 has been proposed to inhibit Th1-mediated immune responses and promote immunological tolerance.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human Tim-3 fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for relevant formats of this clone) include: costimulation1 (clone 2E2 has been shown to enhance T-cell receptor mediated activation and cytokine secretion) and blocking2,3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Hastings WD, et al. 2009. Eur. J. Immunol. 39:2492. (Costim)
  2. Jones RB, et al. 2008. J. Exp. Med. 205:2763. (Block)
  3. Klibi J, et al 2009. Blood 113:1957. (FC, Block)
RRID
AB_2892421 (BioLegend Cat. No. 345057)

Antigen Details

Structure
Transmembrane protein containing immunoglobulin domain and mucin-like domain; can exist as a soluble form lacking mucin and transmembrane domains
Distribution

Activated T cells, preferentially on Th1 cells, monocytes, dendritic cells

Function
Plays a role in regulating macrophage activation, T cell apoptosis and immune tolerance
Ligand/Receptor
Galectin-9
Cell Type
Dendritic cells, Monocytes, T cells, Th1, Tregs
Biology Area
Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Hafler DA and Kuchroo V. 2008. J. Exp. Med. 205:2699.
2. Zhu C, et al. 2005. Nat. Immunol. 6:1245.
3. Wang F, et al. 2009. Immunobiology 214:342.

Gene ID
84868 View all products for this Gene ID
UniProt
View information about CD366 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD366 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD366 (Tim-3) F38-2E2 FC
PE anti-human CD366 (Tim-3) F38-2E2 FC
Brilliant Violet 421™ anti-human CD366 (Tim-3) F38-2E2 FC
Ultra-LEAF™ Purified anti-human CD366 (Tim-3) F38-2E2 FC, Costim, Block
APC anti-human CD366 (Tim-3) F38-2E2 FC
PE/Cyanine7 anti-human CD366 (Tim-3) F38-2E2 FC
PerCP/Cyanine5.5 anti-human CD366 (Tim-3) F38-2E2 FC
Brilliant Violet 605™ anti-human CD366 (Tim-3) F38-2E2 FC
FITC anti-human CD366 (Tim-3) F38-2E2 FC
Purified anti-human CD366 (Tim-3) (Maxpar® Ready) F38-2E2 FC, CyTOF®
Brilliant Violet 711™ anti-human CD366 (Tim-3) F38-2E2 FC
APC/Cyanine7 anti-human CD366 (Tim-3) F38-2E2 FC
Brilliant Violet 785™ anti-human CD366 (Tim-3) F38-2E2 FC
Brilliant Violet 650™ anti-human CD366 (Tim-3) F38-2E2 FC
Brilliant Violet 510™ anti-human CD366 (Tim-3) F38-2E2 FC
PE/Dazzle™ 594 anti-human CD366 (Tim-3) F38-2E2 FC
GoInVivo™ Purified anti-human CD366 (Tim-3) F38-2E2 FC, Costim, Block
APC/Fire™ 750 anti-human CD366 (Tim-3) F38-2E2 FC
Pacific Blue™ anti-human CD366 (Tim-3) F38-2E2 FC
Biotin anti-human CD366 (Tim-3) F38-2E2 FC
TotalSeq™-A0169 anti-human CD366 (Tim-3) F38-2E2 PG
TotalSeq™-C0169 anti-human CD366 (Tim-3) F38-2E2 PG
PE/Cyanine5 anti-human CD366 (Tim-3) F38-2E2 FC
TotalSeq™-B0169 anti-human CD366 (Tim-3) F38-2E2 PG
Brilliant Violet 750™ anti-human CD366 (Tim-3) Antibody F38-2E2 FC
TotalSeq™-D0169 anti-human CD366 (Tim-3) F38-2E2 PG
PE/Fire™ 810 anti-human CD366 (Tim-3) F38-2E2 FC
PE/Fire™ 640 anti-human CD366 (Tim-3) F38-2E2 FC
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD366 (Tim-3)

  • PE anti-human CD366 (Tim-3)

  • Brilliant Violet 421™ anti-human CD366 (Tim-3)

  • Ultra-LEAF™ Purified anti-human CD366 (Tim-3)

  • APC anti-human CD366 (Tim-3)

  • PE/Cyanine7 anti-human CD366 (Tim-3)

  • PerCP/Cyanine5.5 anti-human CD366 (Tim-3)

  • Brilliant Violet 605™ anti-human CD366 (Tim-3)

  • FITC anti-human CD366 (Tim-3)

  • Purified anti-human CD366 (Tim-3) (Maxpar® Ready)

  • Brilliant Violet 711™ anti-human CD366 (Tim-3)

  • APC/Cyanine7 anti-human CD366 (Tim-3)

  • Brilliant Violet 785™ anti-human CD366 (Tim-3)

  • Brilliant Violet 650™ anti-human CD366 (Tim-3)

  • Brilliant Violet 510™ anti-human CD366 (Tim-3)

  • PE/Dazzle™ 594 anti-human CD366 (Tim-3)

  • GoInVivo™ Purified anti-human CD366 (Tim-3)

  • APC/Fire™ 750 anti-human CD366 (Tim-3)

  • Pacific Blue™ anti-human CD366 (Tim-3)

  • Biotin anti-human CD366 (Tim-3)

  • TotalSeq™-A0169 anti-human CD366 (Tim-3)

  • TotalSeq™-C0169 anti-human CD366 (Tim-3)

  • PE/Cyanine5 anti-human CD366 (Tim-3)

  • TotalSeq™-B0169 anti-human CD366 (Tim-3)

  • Brilliant Violet 750™ anti-human CD366 (Tim-3) Antibody

  • TotalSeq™-D0169 anti-human CD366 (Tim-3)

  • PE/Fire™ 810 anti-human CD366 (Tim-3)

  • PE/Fire™ 640 anti-human CD366 (Tim-3)

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account