TotalSeq™-D1056 anti-human CD258 (LIGHT) Antibody

Pricing & Availability
Clone
T5-39 (See other available formats)
Regulatory Status
RUO
Other Names
LIGHT, TL5, TNFSF14, TR2 ligand, Ligand for herpesvirus entry mediator, tumor necrosis factor receptor-like-2 ligand, tumor necrosis factor ligand superfamily member 14 (TNFSF14)
Isotype
Mouse IgG2b, κ
Barcode Sequence
ACTTCCCTGTAGAAA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
318713 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The T5-39 antibody recognizes human LIGHT (CD258) also known as ligand for herpesvirus entry mediator, tumor necrosis factor receptor-like-2 ligand, TR2 ligand, and tumor necrosis factor ligand superfamily member 14 (TNFSF14). LIGHT is a type 2 transmembrane protein, and a member of the tumor necrosis factor ligand superfamily. LIGHT can be proteolytically cleaved and two isofoms have been shown to be produced by alternative splicing. The apparent molecular weight of LIGHT us approximately 30 kD. LIGHT expression has been observed in spleen, brain and kidney; expression is upregulated on activated T cells (particularly CD8+ cells). LIGHT stimulates proliferation of T cells and inhibits growth of some tumor cells. This protein has been shown to play a role in intestinal inflammation and contribute to IgA nephropathy. LIGHT is a ligand for HVEM, and LTβR and has also been shown to bind DcR3 and modulate function. In addition, LIGHT has been shown to interact with other proteins including TRAF2, TRAF3, and DIABLO. The T5-39 antibody has been shown to be useful for flow cytometry and ELISA.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
recombinant human LIGHT (TL5) protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894617 (BioLegend Cat. No. 318713)

Antigen Details

Structure
Type 2 transmembrane protein, member of the tumor necrosis factor ligand superfamily. Can be proteolytically cleaved; two isofoms produced by alternative splicing. Apparent molecular weight approximately 30 kD.
Distribution

Spleen, brain and kidney. Upregulated on activated T cells (particularly CD8+ cells)

Function
Stimulates proliferation of T cells, inhibits growth of some tumor cells. Has been shown to play a role in intestinal inflammation and contribute to IgA nephropathy
Interaction
TRAF2, TRAF3, DIABLO
Ligand/Receptor
Ligand for HVEM, LTβR. Has also been shown to bind DcR3
Cell Type
T cells
Biology Area
Cell Biology, Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Mauri DN, et al. 1998. Immunity 8:21.
2. Harrop JA, et al. 1998. J. Biol. Chem. 273:27548.
3. Morel Y, et al. 2000. J. Immunol. 165:4397.
4. Wang J, et al. 2004. J. Clin. Invest. 113:826.
5. Yu P, et al. 2004. Nature Immunol. 5:141.

Gene ID
8740 View all products for this Gene ID
UniProt
View information about CD258 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/04/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login/Register
Remember me
Forgot your password? Reset Password
Request an Account