- Clone
- 15-2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- MMR (macrophage mannose receptor), MR (mannose receptor), CD206, MRC1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCAGAACGTCTAACT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
321155 | 10 µg | £245 |
Macrophage mannose receptor (MMR) is a 162-175 kD type I membrane protein also known as CD206, MRC1, or mannose receptor (MR). It is a pattern recognition receptor (PRR) that belongs to C-type lectin superfamily. MMR is expressed on macrophages, dendritic cells, and hepatic or lymphatic endothelial cells, but not on monocytes. MMR recognizes a range of microbial carbohydrates bearing mannose, fucose, or N-acetyl glucosamine. MMR mediates endocytosis and phagocytosis, induces activation of macrophages and antigen presentation, plays an important role in host defense, and provides a link between innate and adaptive immunity.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Purified human mannose receptor
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The 15-2 antibody blocks the interaction of MMR with its ligand, and inhibits mannose receptor-mediated degradation of t-PA by macrophages. Additional reported applications of this antibody (for the relevant formats) include: Western blotting1, blocking of ligand binding1,2, immunofluorescence3, and immunohistochemical staining of acetone-fixed frozen tissue sections1. The Utra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 321149 and 321150).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Noorman F, et al. 1997. J. Leukocyte Biol. 61:63. (WB, IHC, Block)
- Barrett-Bergshoeff M, et al. 1997. Thromb Haemost. 77:718. (Block)
- Kato M, et al. 2007. J. Immunol. 179:6052. (IF)
- RRID
-
AB_2927868 (BioLegend Cat. No. 321155)
Antigen Details
- Structure
- Type I membrane protein, Pattern Recognition Receptor (PRR) family, C-type lectin superfamily, 162-175 kD
- Distribution
-
Macrophages, dendritic cells, hepatic and lymphatic endothelial cells
- Function
- Pathogen binding, facilitate phagocytosis and endocytosis, macrophage activation and antigen presentation
- Ligand/Receptor
- Mannose, fucose, N-acetyl glucosamine
- Cell Type
- Dendritic cells, Endothelial cells, Macrophages
- Biology Area
- Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
- Molecular Family
- CD Molecules
- Antigen References
-
1. Mason D, et al. Eds. 2002. Leukocyte Typing VII. Oxford University Press. p303
2. Wileman TE, et al. 1986. P. Natl. Acad. Sci. USA 83:2501.
3. Apostolopoulos V and McKenzie IF. 2001. Curr. Mol. Med. 1:469.
4. Le Cabec V, et al. 2005. J. Leukocyte Biol. 77:934.
5. Barrett-Bergshoeff M, et al. 1997. Thromb. Haemostatis 77:718. - Gene ID
- 4360 View all products for this Gene ID
- UniProt
- View information about CD206 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD206 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD206 (MMR)
-
FITC anti-human CD206 (MMR)
-
PE anti-human CD206 (MMR)
-
PE/Cyanine5 anti-human CD206 (MMR)
-
APC anti-human CD206 (MMR)
-
Alexa Fluor® 488 anti-human CD206 (MMR)
-
Alexa Fluor® 647 anti-human CD206 (MMR)
-
Biotin anti-human CD206 (MMR)
-
APC/Cyanine7 anti-human CD206 (MMR)
-
PerCP/Cyanine5.5 anti-human CD206 (MMR)
-
PE/Cyanine7 anti-human CD206 (MMR)
-
Brilliant Violet 421™ anti-human CD206 (MMR)
-
Purified anti-human CD206 (MMR) (Maxpar® Ready)
-
Alexa Fluor® 700 anti-human CD206 (MMR)
-
PE/Dazzle™ 594 anti-human CD206 (MMR)
-
APC/Fire™ 750 anti-human CD206 (MMR)
-
Brilliant Violet 711™ anti-human CD206 (MMR)
-
Brilliant Violet 510™ anti-human CD206 (MMR)
-
Brilliant Violet 605™ anti-human CD206 (MMR)
-
Brilliant Violet 785™ anti-human CD206 (MMR)
-
TotalSeq™-A0205 anti-human CD206 (MMR)
-
TotalSeq™-B0205 anti-human CD206 (MMR)
-
TotalSeq™-C0205 anti-human CD206 (MMR)
-
Ultra-LEAF™ Purified anti-human CD206 (MMR)
-
Pacific Blue™ anti-human CD206 (MMR)
-
PE/Fire™ 700 anti-human CD206 (MMR)
-
TotalSeq™-D0205 anti-human CD206 (MMR)
-
Spark NIR™ 685 anti-human CD206 (MMR)
-
Spark Red™ 718 anti-human CD206 (MMR) (Flexi-Fluor™)
Follow Us