TotalSeq™-D0372 anti-human CD61 Antibody

Pricing & Availability
VI-PL2 (See other available formats)
Regulatory Status
Other Names
Integrin β3, gpIIIa
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
336429 10 µg £245
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD61, also known as integrin β3 and glycoprotein IIIa (gpIIIa), is a 90 kD type I integral transmembrane glycoprotein. It is a member of the integrin family, associating with platelet gpIIb (CD41) to form CD41/CD61 complex and with integrin αV (CD51) to form αV/β3 (CD51/CD61) integrin. CD41/CD61 is expressed on platelets and megakaryocytes, and plays a role in platelet activation and aggregation through interaction with fibrinogen, fibronectin, vWF, and other RGD-containing adhesion molecules. CD51/CD61 is expressed on platelets, osteoclasts, fibroblasts, macrophages, and some tumor cells involved in tumor metastasis, and in adenovirus infection through binding to RGD motif in extracellular matrix proteins.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting and immunohistochemical staining of frozen tissue sections.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Davies J, et al. 1989. J. Cell Biol. 109:1817.
  2. Roberts M, et al. 2004. Mol. Cell. Biol. 24:1505.
  3. Ciarlet M, et al. 2002. J. Virol. 76:1109.
AB_2922555 (BioLegend Cat. No. 336429)

Antigen Details

Type I integral glycoprotein, integrin family, associates with CD41 (gpIIb) forming CD41/CD61 complex or with CD51 (integrin αV) forming CD51/CD61 complex, 90 kD

CD41/CD61 complex is expressed on platelets and megakaryocytes; CD51/CD61 complex is expressed on platelets, osteoclasts, fibroblasts, macrophages, and some tumor cells

Adhesion, platelet activation and aggregation
Fibronectin, vitronectin, vWF
Cell Type
Fibroblasts, Megakaryocytes, Osteoclasts, Platelets
Biology Area
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers.

Gene ID
3690 View all products for this Gene ID
View information about CD61 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03/24/2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD61

  • FITC anti-human CD61

  • PE anti-human CD61

  • Alexa Fluor® 647 anti-human CD61

  • PerCP anti-human CD61

  • APC anti-human CD61

  • Purified anti-human CD61 (Maxpar® Ready)

  • PE/Cyanine7 anti-human CD61

  • PerCP/Cyanine5.5 anti-human CD61

  • APC/Fire™ 750 anti-human CD61

  • Alexa Fluor® 700 anti-human CD61

  • TotalSeq™-A0372 anti-human CD61

  • PE/Dazzle™ 594 anti-human CD61

  • TotalSeq™-C0372 anti-human CD61

  • TotalSeq™-D0372 anti-human CD61


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account