TotalSeq™-D0386 anti-human CD28 Antibody

Pricing & Availability
CD28.2 (See other available formats)
Regulatory Status
Other Names
T44, Tp44
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
302973 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD28 is a 44 kD disulfide-linked homodimeric type I glycoprotein. It is a member of the immunoglobulin superfamily and is also known as T44 or Tp44. CD28 is expressed on most T lineage cells, NK cell subsets, and plasma cells. CD28 binds both CD80 and CD86 using a highly conserved motif MYPPY in the CDR3-like loop. CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death. In vitro studies indicate that ligation of CD28 on T cells by CD80 and CD86 on antigen presenting cells provides a costimulatory signal required for T cell activation and proliferation.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Capuchin Monkey, Chimpanzee, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Nunes J, et al. 1993. Biochem. J. 293:835.
  3. Calea-Lauri J, et al. 1999. J. Immunol. 163:62.
  4. Tazi A, et al. 1999. J. Immunol. 163:3511. (IHC)
  5. Marti F, et al. 2001. J. Immunol. 166:197. (Costim)
  6. Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim)
  7. Rivollier A, et al. 2004. Blood 104:4029. (Costim)
  8. Scharschmidt E, et al. 2004. Mol. Cell Biol. 24:3860. (Costim)
  9. Sheng W, et al. 2007.Elsevier 580:6819. PubMed
  10. Mitsuhashi M. 2007. Clin Chem.53:148. PubMed
  11. Ye Z, et al. 2008. Infect. Immun. 76:2541. PubMed
  12. Magatti M, et al. 2008. Stem Cells 26:182. (FA) PubMed
  13. Yoshino N, et al. 2008. Exp. Anim. (Tokyo) 49:97. (FC)
  14. Berg M, et al. 2008. J Leukoc Biol. 83:853. (IP) PubMed
  15. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  16. Leonard JA, et al. 2011. J. Virol. 85:6867. PubMed
  17. Nomura T, et al. 2012. J. Virol. 86:6481. PubMed
AB_2910379 (BioLegend Cat. No. 302973)

Antigen Details

Ig superfamily, type I transmembrane glycoprotein, homodimer, 44 kD

Mature T cells, thymocytes, NK cell subsets, plasma cells, EBV-positive B cells

T cell costimulation
CD80, CD86
Cell Type
B cells, NK cells, Plasma cells, T cells, Thymocytes, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
2. June CH, et al. 1994. Immunol. Today 15:321.
3. Linskey PS, et al. 1993. Annu. Rev. Immunol. 11:191.

Gene ID
940 View all products for this Gene ID
View information about CD28 on

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD28 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD28 CD28.2 FC
Biotin anti-human CD28 CD28.2 FC
FITC anti-human CD28 CD28.2 FC
PE anti-human CD28 CD28.2 FC
PE/Cyanine5 anti-human CD28 CD28.2 FC
Purified anti-human CD28 CD28.2 FC, IHC-F, Costim, FA
Alexa Fluor® 488 anti-human CD28 CD28.2 FC
Alexa Fluor® 700 anti-human CD28 CD28.2 FC
PerCP/Cyanine5.5 anti-human CD28 CD28.2 FC
Pacific Blue™ anti-human CD28 CD28.2 FC
PE/Cyanine7 anti-human CD28 CD28.2 FC
Ultra-LEAF™ Purified anti-human CD28 CD28.2 FC, IHC-F, Costim, FA
Brilliant Violet 421™ anti-human CD28 CD28.2 FC
Brilliant Violet 510™ anti-human CD28 CD28.2 FC
Purified anti-human CD28 (Maxpar® Ready) CD28.2 FC, CyTOF®
PE/Dazzle™ 594 anti-human CD28 CD28.2 FC
Brilliant Violet 785™ anti-human CD28 CD28.2 FC
Brilliant Violet 650™ anti-human CD28 CD28.2 FC
Brilliant Violet 711™ anti-human CD28 CD28.2 FC
APC/Fire™ 750 anti-human CD28 CD28.2 FC
Alexa Fluor® 647 anti-human CD28 CD28.2 FC
TotalSeq™-A0386 anti-human CD28 CD28.2 PG
TotalSeq™-B0386 anti-human CD28 CD28.2 PG
TotalSeq™-C0386 anti-human CD28 CD28.2 PG
Brilliant Violet 605™ anti-human CD28 CD28.2 FC
APC/Cyanine7 anti-human CD28 CD28.2 FC
PE anti-human CD28 CD28.2 FC
APC anti-human CD28 CD28.2 FC
Brilliant Violet 750™ anti-human CD28 CD28.2 FC
PE/Fire™ 810 anti-human CD28 CD28.2 FC
GMP PE anti-human CD28 CD28.2 FC
TotalSeq™-D0386 anti-human CD28 CD28.2 PG
Spark Violet™ 423 anti-human CD28 CD28.2 FC
Go To Top Version: 1    Revision Date: 01.19.2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD28

  • Biotin anti-human CD28

  • FITC anti-human CD28

  • PE anti-human CD28

  • PE/Cyanine5 anti-human CD28

  • Purified anti-human CD28

  • Alexa Fluor® 488 anti-human CD28

  • Alexa Fluor® 700 anti-human CD28

  • PerCP/Cyanine5.5 anti-human CD28

  • Pacific Blue™ anti-human CD28

  • PE/Cyanine7 anti-human CD28

  • Ultra-LEAF™ Purified anti-human CD28

  • Brilliant Violet 421™ anti-human CD28

  • Brilliant Violet 510™ anti-human CD28

  • Purified anti-human CD28 (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD28

  • Brilliant Violet 785™ anti-human CD28

  • Brilliant Violet 650™ anti-human CD28

  • Brilliant Violet 711™ anti-human CD28

  • APC/Fire™ 750 anti-human CD28

  • Alexa Fluor® 647 anti-human CD28

  • TotalSeq™-A0386 anti-human CD28

  • TotalSeq™-B0386 anti-human CD28

  • TotalSeq™-C0386 anti-human CD28

  • Brilliant Violet 605™ anti-human CD28

  • APC/Cyanine7 anti-human CD28

  • PE anti-human CD28

  • APC anti-human CD28

  • Brilliant Violet 750™ anti-human CD28

  • PE/Fire™ 810 anti-human CD28

  • GMP PE anti-human CD28

  • TotalSeq™-D0386 anti-human CD28

  • Spark Violet™ 423 anti-human CD28


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account