TotalSeq™-D0163 anti-human CD141 (Thrombomodulin) Antibody

Pricing & Availability
M80 (See other available formats)
Regulatory Status
Other Names
Thrombomodulin, TM, THRM, THBD, Fetomodulin, BDCA-3
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
344131 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD141 is a 75 kD, single chain, type I membrane glycoprotein also known as thrombomodulin, TM, THRM, THBD, and fetomodulin. CD141 is an important cofactor in the protein C anticoagulant system. After binding to its ligand thrombin, CD141 activates protein C, which degrades clotting factors Va and VIIIa, and as a consequence the amount of thrombin is reduced. CD141 is expressed on macrophages, monocytes, a subpopulation of myeloid dendritic cells, vascular endothelial cells, and keratinocytes. Besides anti-coagulation function, CD141 is also involved in embryonic and atherosclerotic plaque development. 

Product Details
Technical data sheet

Product Details

Verified Reactivity
Reported Reactivity
African Green, Baboon
Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

AB_2892418 (BioLegend Cat. No. 344131)

Antigen Details

Single chain, type I membrane glycoprotein, 75 kD

Macrophages, monocytes, subset of myeloid dendritic cells, vascular endothelial cells, keratinocytes

After thrombin binding, CD141 activates protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated.
Protein C, Thrombin-activatable fibrinolysis inhibitor (TAFI), Platelet factor 4 (PF4)
Cell Type
Dendritic cells, Endothelial cells, Macrophages, Monocytes
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules
Antigen References

1. Suzuki K, et al. 1987. EMBO J. 6:1891.
2. Esmon CT, et al. 1989. J. Biol. Chem. 264:4743.
3. Delvaeye M, et al. 2009. N. Engl. J. Med. 361:345.
4. Shi CS, et al. 2008. Blood 112:3661.
5. Chen LC, et al. 2009. J. Infect. 58:368.

Gene ID
7056 View all products for this Gene ID
View information about CD141 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.21.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD141 (Thrombomodulin)

  • PE anti-human CD141 (Thrombomodulin)

  • APC anti-human CD141 (Thrombomodulin)

  • Biotin anti-human CD141 (Thrombomodulin)

  • PE/Cyanine7 anti-human CD141 (Thrombomodulin)

  • PerCP/Cyanine5.5 anti-human CD141 (Thrombomodulin)

  • Brilliant Violet 421™ anti-human CD141 (Thrombomodulin)

  • Brilliant Violet 785™ anti-human CD141 (Thrombomodulin)

  • Brilliant Violet 605™ anti-human CD141 (Thrombomodulin)

  • PE/Dazzle™ 594 anti-human CD141 (Thrombomodulin)

  • TotalSeq™-A0163 anti-human CD141 (Thrombomodulin)

  • Alexa Fluor® 647 anti-human CD141 (Thrombomodulin)

  • TotalSeq™-C0163 anti-human CD141 (Thrombomodulin)

  • TotalSeq™-B0163 anti-human CD141 (Thrombomodulin)

  • KIRAVIA Blue 520™ anti-human CD141 (Thrombomodulin)

  • TotalSeq™-D0163 anti-human CD141 (Thrombomodulin)

  • PE/Fire™ 810 anti-human CD141 (Thrombomodulin)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account