TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl Antibody

Pricing & Availability
MPC-11 (See other available formats)
Regulatory Status
Mouse IgG2b, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
400383 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

The MPC-11 immunoglobulin has unknown specificity. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.

Product Details
Technical Data Sheet (pdf)

Product Details

Antibody Type
Host Species
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Intracellular Flow Cytometry (ICFC), Immunocytochemistry (ICC), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western Blotting (WB), Functional Assay (FA).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Smed-Sörensen A, et al. 2008. Blood 111:5037. (FA) PubMed
  2. Podolin PL, et al. 2008. J. Immunol. 180:7989. (FC) PubMed

Antigen Details

Gene ID

Related FAQs

There are no FAQs for this product.

Other Formats

View All Reagents Request Custom Conjugation
Description Clone Applications
APC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Biotin Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
FITC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
PE Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
PE/Cyanine5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Purified Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC, ICC, IHC, IP, WB, FA, ChIP
APC/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Alexa Fluor® 647 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Alexa Fluor® 488 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Alexa Fluor® 700 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
PerCP Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Brilliant Violet 421™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Brilliant Violet 570™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Brilliant Violet 510™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Ultra-LEAF™ Purified Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC, ICC, IHC, IP, WB, FA
Brilliant Violet 605™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Brilliant Violet 650™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Brilliant Violet 711™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
Brilliant Violet 785™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
PE/Dazzle™ 594 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
Alexa Fluor® 594 Mouse IgG2b, κ Isotype Ctrl MPC-11 ICC
APC/Fire™ 750 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC
GoInVivo™ Purified Mouse IgG2b, κ Isotype Ctrl MPC-11 FC, ICFC, ICC, IHC, IP, WB, FA
FITC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
APC Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-A0092 Mouse IgG2b, κ isotype Ctrl MPC-11 PG
Go-ChIP-Grade™ Purified Mouse IgG2b, κ isotype Ctrl MPC-11
PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-B0092 Mouse IgG2b, κ isotype Ctrl MPC-11 PG
TotalSeq™-C0092 Mouse IgG2b, κ isotype Ctrl MPC-11 PG
PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl MPC-11 FC
TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl MPC-11 PG
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC Mouse IgG2b, κ Isotype Ctrl

  • Biotin Mouse IgG2b, κ Isotype Ctrl

  • FITC Mouse IgG2b, κ Isotype Ctrl

  • PE Mouse IgG2b, κ Isotype Ctrl

  • PE/Cyanine5 Mouse IgG2b, κ Isotype Ctrl

  • Purified Mouse IgG2b, κ Isotype Ctrl

  • APC/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 647 Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 488 Mouse IgG2b, κ Isotype Ctrl

  • Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 700 Mouse IgG2b, κ Isotype Ctrl

  • PerCP Mouse IgG2b, κ Isotype Ctrl

  • PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 421™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 570™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 510™ Mouse IgG2b, κ Isotype Ctrl

  • Ultra-LEAF™ Purified Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 605™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 650™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 711™ Mouse IgG2b, κ Isotype Ctrl

  • Brilliant Violet 785™ Mouse IgG2b, κ Isotype Ctrl

  • PE/Dazzle™ 594 Mouse IgG2b, κ Isotype Ctrl

  • Alexa Fluor® 594 Mouse IgG2b, κ Isotype Ctrl

  • APC/Fire™ 750 Mouse IgG2b, κ Isotype Ctrl

  • GoInVivo™ Purified Mouse IgG2b, κ Isotype Ctrl

  • FITC Mouse IgG2b, κ Isotype Ctrl

  • Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl

  • APC Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-A0092 Mouse IgG2b, κ isotype Ctrl

  • Go-ChIP-Grade™ Purified Mouse IgG2b, κ isotype Ctrl

  • PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-B0092 Mouse IgG2b, κ isotype Ctrl

  • TotalSeq™-C0092 Mouse IgG2b, κ isotype Ctrl

  • PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl

  • TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account